Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 1291234
End position: 1291257
Length: 24

DNA sequence
>NC_000909, from 1291234 to 1291257 (24 bp); Methanococcus jannaschii AATATCAATAACATTATCAACATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1291124-1291462	Sequence	MJ_1344 - nitrogen regulatory protein P-II GlnB (Protein is coded in complementary strand; from 1291462 to 1291124)