Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 904305
End position: 904328
Length: 24

DNA sequence
>NC_000909, from 904305 to 904328 (24 bp); Methanococcus jannaschii ATGATGATGGTGGTGATGATGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 904195-904626	Sequence	MJ_0970 - sirohydrochlorin cobaltochelatase (Protein is coded in complementary strand; from 904626 to 904195)