Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 938202
End position: 938225
Length: 24

DNA sequence
>NC_000909, from 938202 to 938225 (24 bp); Methanococcus jannaschii AATTTTTTAACTTTTTTATTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 938225-939091	Sequence	MJ_1008 - branched-chain amino acid aminotransferase (Protein is coded in complementary strand; from 939091 to 938225)