Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 621285
End position: 621309
Length: 25

DNA sequence
>NC_000909, from 621285 to 621309 (25 bp); Methanococcus jannaschii AAAGAAAAAAAAGGATAAGAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 620123-621367	Sequence	MJ_0694 - C/D box methylation guide ribonucleoprotein complex aNOP56 subunit