Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 119930
End position: 119956
Length: 27

DNA sequence
>NC_000909, from 119930 to 119956 (27 bp); Methanococcus jannaschii TAATCTTTCCAATCTTTCTAATATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 119511-122738	Sequence	MJ_0124m - Type I restriction-modification enzyme helicase subunit (Protein is coded in complementary strand; from 122738 to 119511)