Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 1089893
End position: 1089922
Length: 30

DNA sequence
>NC_000909, from 1089893 to 1089922 (30 bp); Methanococcus jannaschii ATAAAATGAAAGAAAATATATTAAAACAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1089681-1089902	Sequence	MJ_1152 - hypothetical protein
ORF... 1089899-1090087	Sequence	MJ_1153 - hypothetical protein