Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 1509863
End position: 1509892
Length: 30

DNA sequence
>NC_000909, from 1509863 to 1509892 (30 bp); Methanococcus jannaschii TCTTTTTCTTCTTCTTTCTCCTTTTCTTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1509602-1511530	Sequence	MJ_1533 - ATPase (Protein is coded in complementary strand; from 1511530 to 1509602)