Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 205661
End position: 205690
Length: 30

DNA sequence
>NC_000909, from 205661 to 205690 (30 bp); Methanococcus jannaschii AAATATAAATGAATAAAAATAAATTAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 205184-205663	Sequence	MJ_0215 - hypothetical protein (Protein is coded in complementary strand; from 205663 to 205184)