Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 260480
End position: 260509
Length: 30

DNA sequence
>NC_000909, from 260480 to 260509 (30 bp); Methanococcus jannaschii AAAATTAAAATTAAAAATAAAATGAAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 260510-261124	Sequence	MJ_0275 - hypothetical protein (Protein is coded in complementary strand; from 261124 to 260510)