Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 781971
End position: 782000
Length: 30

DNA sequence
>NC_000909, from 781971 to 782000 (30 bp); Methanococcus jannaschii TTTGCTATTGTTTGTTATTATTTGATATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 781976-782317	Sequence	MJ_0858 - hypothetical protein (Protein is coded in complementary strand; from 782317 to 781976)