Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 782324
End position: 782353
Length: 30

DNA sequence
>NC_000909, from 782324 to 782353 (30 bp); Methanococcus jannaschii CTTAATTAATGTTAATTATTCTTATTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 782351-782845	Sequence	MJ_0859 - hypothetical protein (Protein is coded in complementary strand; from 782845 to 782351)