Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 814798
End position: 814827
Length: 30

DNA sequence
>NC_000909, from 814798 to 814827 (30 bp); Methanococcus jannaschii ATTTTTATTTATTTTTTTATGTTTAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 811397-816301	Sequence	MJ_0885 - DNA polymerase B1 (Protein is coded in complementary strand; from 816301 to 811397)