Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 1002076
End position: 1002108
Length: 33

DNA sequence
>NC_000909, from 1002076 to 1002108 (33 bp); Methanococcus jannaschii TTTCTTTTAATATTTTTTTAATTTTCTCTTTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1002063-1003064	Sequence	MJ_1061 - capsular polysaccharide biosynthesis protein D (Protein is coded in complementary strand; from 1003064 to 1002063)