Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 1547781
End position: 1547813
Length: 33

DNA sequence
>NC_000909, from 1547781 to 1547813 (33 bp); Methanococcus jannaschii TCAATATTATTTCAAAATTATTTCAAAAATATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1546980-1547816	Sequence	MJ_1572 - cobalt transport ATP-binding protein CbiO
ORF... 1547813-1548151	Sequence	MJ_1572.1 - hypothetical protein (Protein is coded in complementary strand; from 1548151 to 1547813)