Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 233664
End position: 233696
Length: 33

DNA sequence
>NC_000909, from 233664 to 233696 (33 bp); Methanococcus jannaschii CTTTTTTATTATTTTTCTATTAATTTTTAATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 233695-233994	Sequence	MJ_0246 - chorismate mutase (Protein is coded in complementary strand; from 233994 to 233695)