Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 262122
End position: 262157
Length: 36

DNA sequence
>NC_000909, from 262122 to 262157 (36 bp); Methanococcus jannaschii ATATGGCTTTTTACATGGCTTTTCTTCTGGCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 261628-262728	Sequence	MJ_0276 - 2-oxoglutarate ferredoxin oxidoreductase subunit alpha (Protein is coded in complementary strand; from 262728 to 261628)