Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 448457
End position: 448501
Length: 45

DNA sequence
>NC_000909, from 448457 to 448501 (45 bp); Methanococcus jannaschii TATCTTCTTCCTTCTTCTCTTCTTTTTTCTCTTCTTCTTTCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 448420-448728	Sequence	MJ_0508 rpl12p 50S ribosomal protein L12 (Protein is coded in complementary strand; from 448728 to 448420)