Sequence retrieval

Genome: Methanococcus jannaschii
Start position: 448886
End position: 448930
Length: 45

DNA sequence
>NC_000909, from 448886 to 448930 (45 bp); Methanococcus jannaschii TATCTTCTTCTTTCTTCTCTTCCTCTTTTTTCTCTTCTTCTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 448855-449871	Sequence	MJ_0509 rplP0 acidic ribosomal protein P0 (Protein is coded in complementary strand; from 449871 to 448855)