Sequence retrieval

Genome: Methanothermobacter thermoautotrophicus str. Delta H
Start position: 1085235
End position: 1085266
Length: 32

DNA sequence
>NC_000916, from 1085235 to 1085266 (32 bp); Methanothermobacter thermoautotrophicus str. Delta H TGAATCACTGAATCACTGAATCACTGAATCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1085256-1086173	Sequence	MTH1180 - hypothetical protein (Protein is coded in complementary strand; from 1086173 to 1085256)