Sequence retrieval

Genome: Methanothermobacter thermoautotrophicus str. Delta H
Start position: 603391
End position: 603426
Length: 36

DNA sequence
>NC_000916, from 603391 to 603426 (36 bp); Methanothermobacter thermoautotrophicus str. Delta H GGAACACCACCAGGAACACCACCAGGAACACCACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 603127-606027	Sequence	MTH674 - hypothetical protein (Protein is coded in complementary strand; from 606027 to 603127)