Sequence retrieval

Genome: Sulfolobus solfataricus
Start position: 1048817
End position: 1048853
Length: 37

DNA sequence
>NC_002754, from 1048817 to 1048853 (37 bp); Sulfolobus solfataricus TTGGTTGAGGATTTGGCTGAGGAGTTGGGTGTGGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1047747-1049813	Sequence	SSO1209 cutA-1 carbon monoxide dehydrogenase, large chain CutA