Sequence retrieval

Genome: Sulfolobus solfataricus
Start position: 1160427
End position: 1160456
Length: 30

DNA sequence
>NC_002754, from 1160427 to 1160456 (30 bp); Sulfolobus solfataricus TTTTCTTATCTTTTCTCTTCTTATCTTCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1159034-1160713	Sequence	SSO1328 - restriction endonuclease-like protein (Protein is coded in complementary strand; from 1160713 to 1159034)