Sequence retrieval

Genome: Sulfolobus solfataricus
Start position: 1704426
End position: 1704449
Length: 24

DNA sequence
>NC_002754, from 1704426 to 1704449 (24 bp); Sulfolobus solfataricus CCTAGCCCTATCCCTAGTCCTAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1704103-1705134	Sequence	SSO1889 - ATP-dependent RNA helicase (Protein is coded in complementary strand; from 1705134 to 1704103)