Sequence retrieval

Genome: Sulfolobus solfataricus
Start position: 2684739
End position: 2684763
Length: 25

DNA sequence
>NC_002754, from 2684739 to 2684763 (25 bp); Sulfolobus solfataricus CCCTTTCCGTTTCCCTTTCCATTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2684189-2684917	Sequence	SSO2939 maiA maleate cis-trans isomerase (Protein is coded in complementary strand; from 2684917 to 2684189)