Sequence retrieval

Genome: Sulfolobus solfataricus
Start position: 506419
End position: 506449
Length: 31

DNA sequence
>NC_002754, from 506419 to 506449 (31 bp); Sulfolobus solfataricus CCTCTTTCATCCTTTTTCTTACACTTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 506253-507260	Sequence	SSO0576 ilvC-1 ketol-acid reductoisomerase (Protein is coded in complementary strand; from 507260 to 506253)