Sequence retrieval

Genome: Sulfolobus solfataricus
Start position: 902530
End position: 902574
Length: 45

DNA sequence
>NC_002754, from 902530 to 902574 (45 bp); Sulfolobus solfataricus TATTTTTTCTTTTTCTAATTTTTCTTCATCTATTTTTACTCTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 902135-903010	Sequence	SSO1043 - hypothetical protein (Protein is coded in complementary strand; from 903010 to 902135)