Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 1498941
End position: 1498986
Length: 46

DNA sequence
>NC_002935, from 1498941 to 1498986 (46 bp); Corynebacterium diphtheriae GTGCTGCTGGCTTAGGCGCAGCTGGTTTAGGAGCCGCAGGCTTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1496519-1499380	Sequence	DIP1477 infB translation initiation factor IF-2 (Protein is coded in complementary strand; from 1499380 to 1496519)