Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 2049326
End position: 2049359
Length: 34

DNA sequence
>NC_002935, from 2049326 to 2049359 (34 bp); Corynebacterium diphtheriae TTGCAGGGGTCGCAGGGGTCGCAGGGGTTGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2049007-2051481	Sequence	DIP2002 ftsH cell division protein (Protein is coded in complementary strand; from 2051481 to 2049007)