Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 2342753
End position: 2342776
Length: 24

DNA sequence
>NC_002935, from 2342753 to 2342776 (24 bp); Corynebacterium diphtheriae CTTCGGCTGCGGCTGCGGCTTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2342131-2343621	Sequence	DIP2251 - sodium/alanine symporter (Protein is coded in complementary strand; from 2343621 to 2342131)