Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 2440293
End position: 2440320
Length: 28

DNA sequence
>NC_002935, from 2440293 to 2440320 (28 bp); Corynebacterium diphtheriae GGTGCTGCTGGTCCTGCTGGTGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2438839-2440401	Sequence	DIP2333 ulaA PTS system ascorbate-specific transporter subunit IIC