Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 573803
End position: 573829
Length: 27

DNA sequence
>NC_002935, from 573803 to 573829 (27 bp); Corynebacterium diphtheriae CTGGAAGGCATGGAAGGCGTGGAAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 573656-575113	Sequence	DIP0607 - hypothetical protein (Protein is coded in complementary strand; from 575113 to 573656)