Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 608072
End position: 608098
Length: 27

DNA sequence
>NC_002935, from 608072 to 608098 (27 bp); Corynebacterium diphtheriae ACGATCTACACGATCTTCACGATCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 608070-609302	Sequence	DIP0637 - peptidoglycan synthesis-like protein (Protein is coded in complementary strand; from 609302 to 608070)