Sequence retrieval

Genome: Corynebacterium diphtheriae
Start position: 978933
End position: 978962
Length: 30

DNA sequence
>NC_002935, from 978933 to 978962 (30 bp); Corynebacterium diphtheriae TGGTGGGCGCTGGTGGGCGCTGGTGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 978917-979228	Sequence	DIP1005 - transposase remnant (Protein is coded in complementary strand; from 979228 to 978917)