Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 463607
End position: 463630
Length: 24

DNA sequence
>NC_002952, from 463607 to 463630 (24 bp); Staphylococcus aureus subsp. aureus MRSA252 GGAAAATAGCAAAATAGAAAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 462913-464145	Sequence	SAR0434 - restriction and modification system specificity protein