Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 1148502
End position: 1148528
Length: 27

DNA sequence
>NC_002952, from 1148502 to 1148528 (27 bp); Staphylococcus aureus subsp. aureus MRSA252 GCTTTAACTTCTTTAACTGCTTTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1146876-1148834	Sequence	SAR1102 isdB iron-regulated heme-iron binding protein (Protein is coded in complementary strand; from 1148834 to 1146876)