Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 1360344
End position: 1360370
Length: 27

DNA sequence
>NC_002952, from 1360344 to 1360370 (27 bp); Staphylococcus aureus subsp. aureus MRSA252 ACTTAATTTAACTTTTCTTAACTGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1360297-1360680	Sequence	SAR1294 - hypothetical protein (Protein is coded in complementary strand; from 1360680 to 1360297)