Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 1476232
End position: 1476257
Length: 26

DNA sequence
>NC_002952, from 1476232 to 1476257 (26 bp); Staphylococcus aureus subsp. aureus MRSA252 ATTTCAATTCATTTAGTTTCATGTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1475682-1477025	Sequence	SAR1419 - branched-chain amino acid transporter protein (Protein is coded in complementary strand; from 1477025 to 1475682)