Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 1827861
End position: 1827887
Length: 27

DNA sequence
>NC_002952, from 1827861 to 1827887 (27 bp); Staphylococcus aureus subsp. aureus MRSA252 TTCTTTTTTTATCTTTTCTATTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1827013-1827933	Sequence	SAR1763 dnaI primosomal protein DnaI (Protein is coded in complementary strand; from 1827933 to 1827013)