Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 1909345
End position: 1909375
Length: 31

DNA sequence
>NC_002952, from 1909345 to 1909375 (31 bp); Staphylococcus aureus subsp. aureus MRSA252 TTTTTTGACGTTTTTGGTCGTTTCTTGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1909322-1910764	Sequence	SAR1827 - transposase (Protein is coded in complementary strand; from 1910764 to 1909322)