Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus MRSA252
Start position: 2802805
End position: 2802860
Length: 56

DNA sequence
>NC_002952, from 2802805 to 2802860 (56 bp); Staphylococcus aureus subsp. aureus MRSA252 TCGCTATCTGAATCTGAGTCACTATCTGAGTCCGAGTCACTGTCTGAATCTGACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2802106-2804727	Sequence	SAR2709 clfB fibrinogen and keratin-10 binding surface anchored protein (Protein is coded in complementary strand; from 2804727 to 2802106)