Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 1556297
End position: 1556322
Length: 26

DNA sequence
>NC_002971, from 1556297 to 1556322 (26 bp); Coxiella burnetii RSA 493 TTCATATTTTTTTTCTTTCTTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1555989-1556408	Sequence	CBU_1614 - hypothetical protein (Protein is coded in complementary strand; from 1556408 to 1555989)