Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 602436
End position: 602462
Length: 27

DNA sequence
>NC_002971, from 602436 to 602462 (27 bp); Coxiella burnetii RSA 493 CCGCCTTCTCCACCTTCTCCGCCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 602388-602819	Sequence	CBU_0658 - hypothetical protein (Protein is coded in complementary strand; from 602819 to 602388)