Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 1121230
End position: 1121259
Length: 30

DNA sequence
>NC_002971, from 1121230 to 1121259 (30 bp); Coxiella burnetii RSA 493 CGATGGCCATGGCGCTGGCGTTGGCTATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1121188-1122384	Sequence	CBU_1179 - Bcr/CflA subfamily drug resistance transporter