Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 1647625
End position: 1647660
Length: 36

DNA sequence
>NC_002971, from 1647625 to 1647660 (36 bp); Coxiella burnetii RSA 493 ATCATGCCGCCCATGCCGCCCATTCCTCCCATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1647622-1649280	Sequence	CBU_1718 groEL molecular chaperone GroEL (Protein is coded in complementary strand; from 1649280 to 1647622)