Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 1351033
End position: 1351079
Length: 47

DNA sequence
>NC_002971, from 1351033 to 1351079 (47 bp); Coxiella burnetii RSA 493 TCTTTCTTTTCTTCTTTTTTCTCTTTTTCTTTTTTCGTTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1350133-1351350	Sequence	CBU_1398 sucB dihydrolipoyllysine-residue succinyltransferase, E2 component of oxoglutarate dehydrogenase (succinyl-transferring) complex (Protein is coded in complementary strand; from 1351350 to 1350133)