Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 259556
End position: 259603
Length: 48

DNA sequence
>NC_002971, from 259556 to 259603 (48 bp); Coxiella burnetii RSA 493 GACAGAGGACAGAAGACAGAAGACAGAAGACAGAAGACAGAAGACAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 259529-259885	Sequence	CBU_0291b - hypothetical protein (Protein is coded in complementary strand; from 259885 to 259529)