Sequence retrieval

Genome: Coxiella burnetii RSA 493
Start position: 448209
End position: 448262
Length: 54

DNA sequence
>NC_002971, from 448209 to 448262 (54 bp); Coxiella burnetii RSA 493 TCCTTGTTGCAATCCTTTTTGTAATCCTTGTTGAATTCCTTGTTGAATTCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 448018-449058	Sequence	CBU_0507 - hypothetical protein (Protein is coded in complementary strand; from 449058 to 448018)