Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 1113580
End position: 1113604
Length: 25

DNA sequence
>NC_002973, from 1113580 to 1113604 (25 bp); Listeria monocytogenes str. 4b F2365 TTATCGCCAACATCAAAACGCTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1113463-1114350	Sequence	LMOf2365_1099 galU UTP-glucose-1-phosphate uridylyltransferase (Protein is coded in complementary strand; from 1114350 to 1113463)