Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 1624342
End position: 1624380
Length: 39

DNA sequence
>NC_002973, from 1624342 to 1624380 (39 bp); Listeria monocytogenes str. 4b F2365 GTTGCGAGTGTTGCTAGTTCGCGAACAGATTGACTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1624201-1624656	Sequence	LMOf2365_1623 - hypothetical protein (Protein is coded in complementary strand; from 1624656 to 1624201)