Sequence retrieval

Genome: Listeria monocytogenes str. 4b F2365
Start position: 168406
End position: 168450
Length: 45

DNA sequence
>NC_002973, from 168406 to 168450 (45 bp); Listeria monocytogenes str. 4b F2365 AGTACCGCCAACACCAGTACCACCAACACCAATACCGCCTACTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 166599-168668	Sequence	LMOf2365_0174 - cell wall surface anchor family protein